scrambled aav sirna control viral vector (serotype 5 (Applied Biological Materials Inc)
90
Structured Review
Applied Biological Materials Inc
scrambled aav sirna control viral vector (serotype 5
Scrambled Aav Sirna Control Viral Vector (Serotype 5, supplied by Applied Biological Materials Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/scrambled+aav+sirna+control+viral+vector+(serotype+5/scrambled+aav+sirna+control+viral+vector++serotype+5/pm37569320-298-58-67
Average 90 stars, based on 1 article reviews
Scrambled Aav Sirna Control Viral Vector (Serotype 5, supplied by Applied Biological Materials Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/scrambled+aav+sirna+control+viral+vector+(serotype+5/scrambled+aav+sirna+control+viral+vector++serotype+5/pm37569320-298-58-67
Average 90 stars, based on 1 article reviews
scrambled aav sirna control viral vector (serotype 5 - by Bioz Stars,
2026-10
90/100 stars
Images
Related Articles
Bioprocessing:Article Title: Hmgb1 Silencing in the Amygdala Inhibits Pain-Related Behaviors in a Rat Model of Neuropathic Pain Article Snippet: For stereotaxic injection, male and female rats were anesthetized with isoflurane (2–3%; precision vaporizer, Harvard Apparatus, Holliston, MA, USA) and a small unilateral craniotomy was performed as described previously [ , , ]. .. A stereotaxic apparatus (David Kopf Instruments, Tujunga, CA, USA) was used to inject 1 μL of either Hmgb1 AAV siRNA viral vector of 4 pooled oligomers (serotype 5) (originally purchased as cat. #234960960215, now cat. #23496164, customized to serotype; Applied Biological Materials, Richmond, BC, Canada; target sequences: 70 CGGGAGGAGCACAAGAAGAAGCACCCGGA, 196 GCTGACAAGGCTCGTTATGAAAGAGAAAT, 365 TTGGTGATGTTGCAAAGAAACTAGGAGAG, 442 GCTGCCAAGCTGAAGGAGAAGTATGAGAA) or the scrambled Article Title: Hmgb1 Silencing in the Amygdala Inhibits Pain-Related Behaviors in a Rat Model of Neuropathic Pain. Article Snippet: For stereotaxic injection, male and female rats were anesthetized with isoflurane (2–3%; precision vaporizer, Harvard Apparatus, Holliston, MA, USA) and a small unilateral craniotomy was performed as described previously [50,90,112]. .. A stereotaxic apparatus (David Kopf Instruments, Tujunga, CA, USA) was used to inject 1 μL of either Hmgb1 AAV siRNA viral vector of 4 pooled oligomers (serotype 5) (originally purchased as cat. #234960960215, now cat. #23496164, customized to serotype; Applied Biological Materials, Richmond, BC, Canada; target sequences: 70 CGGGAGGAGCACAAGAAGAAGCACCCGGA, 196 GCTGACAAGGCTCGTTATGAAAGAGAAAT, 365 TTGGTGATGTTGCAAAGAAACTAGGAGAG, 442 GCTGCCAAGCTGAAGGAGAAGTATGAGAA) or the scrambled Control:Article Title: Hmgb1 Silencing in the Amygdala Inhibits Pain-Related Behaviors in a Rat Model of Neuropathic Pain Article Snippet: For stereotaxic injection, male and female rats were anesthetized with isoflurane (2–3%; precision vaporizer, Harvard Apparatus, Holliston, MA, USA) and a small unilateral craniotomy was performed as described previously [ , , ]. .. A stereotaxic apparatus (David Kopf Instruments, Tujunga, CA, USA) was used to inject 1 μL of either Hmgb1 AAV siRNA viral vector of 4 pooled oligomers (serotype 5) (originally purchased as cat. #234960960215, now cat. #23496164, customized to serotype; Applied Biological Materials, Richmond, BC, Canada; target sequences: 70 CGGGAGGAGCACAAGAAGAAGCACCCGGA, 196 GCTGACAAGGCTCGTTATGAAAGAGAAAT, 365 TTGGTGATGTTGCAAAGAAACTAGGAGAG, 442 GCTGCCAAGCTGAAGGAGAAGTATGAGAA) or the scrambled Article Title: Hmgb1 Silencing in the Amygdala Inhibits Pain-Related Behaviors in a Rat Model of Neuropathic Pain. Article Snippet: For stereotaxic injection, male and female rats were anesthetized with isoflurane (2–3%; precision vaporizer, Harvard Apparatus, Holliston, MA, USA) and a small unilateral craniotomy was performed as described previously [50,90,112]. .. A stereotaxic apparatus (David Kopf Instruments, Tujunga, CA, USA) was used to inject 1 μL of either Hmgb1 AAV siRNA viral vector of 4 pooled oligomers (serotype 5) (originally purchased as cat. #234960960215, now cat. #23496164, customized to serotype; Applied Biological Materials, Richmond, BC, Canada; target sequences: 70 CGGGAGGAGCACAAGAAGAAGCACCCGGA, 196 GCTGACAAGGCTCGTTATGAAAGAGAAAT, 365 TTGGTGATGTTGCAAAGAAACTAGGAGAG, 442 GCTGCCAAGCTGAAGGAGAAGTATGAGAA) or the scrambled |